Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pFasBac+GFP-CAMSAP2
(Plasmid #59037)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 59037 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pFasBac
  • Modifications to backbone
    eGFP added between BamHI and XhoI sites
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CAMSAP2
  • Species
    H. sapiens (human)
  • Entrez Gene
    CAMSAP2 (a.k.a. CAMSAP1L1)
  • Tags / Fusion Proteins
    • His (N terminal on insert)
    • eGFP (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AAATGATAACCATCTCGC
  • 3′ sequencing primer CAAATGTGGTATGGCTGATT
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFasBac+GFP-CAMSAP2 was a gift from Ron Vale (Addgene plasmid # 59037 ; http://n2t.net/addgene:59037 ; RRID:Addgene_59037)
  • For your References section:

    Regulation of microtubule minus-end dynamics by CAMSAPs and Patronin. Hendershott MC, Vale RD. Proc Natl Acad Sci U S A. 2014 Apr 22;111(16):5860-5. doi: 10.1073/pnas.1404133111. Epub 2014 Mar 26. 10.1073/pnas.1404133111 PubMed 24706919