Skip to main content

pFasBac+GFP-CAMSAP2 CC+CKK
(Plasmid #59039)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59039 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFasBac
  • Modifications to backbone
    eGFP added between BamHI and XhoI sites
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CAMSAP2 CC+CKK domains
  • Species
    H. sapiens (human)
  • Entrez Gene
    CAMSAP2 (a.k.a. CAMSAP1L1)
  • Tags / Fusion Proteins
    • His (N terminal on insert)
    • eGFP (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AAATGATAACCATCTCGC
  • 3′ sequencing primer CAAATGTGGTATGGCTGATT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFasBac+GFP-CAMSAP2 CC+CKK was a gift from Ron Vale (Addgene plasmid # 59039 ; http://n2t.net/addgene:59039 ; RRID:Addgene_59039)
  • For your References section:

    Regulation of microtubule minus-end dynamics by CAMSAPs and Patronin. Hendershott MC, Vale RD. Proc Natl Acad Sci U S A. 2014 Apr 22;111(16):5860-5. doi: 10.1073/pnas.1404133111. Epub 2014 Mar 26. 10.1073/pnas.1404133111 PubMed 24706919