Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pINDgw RFA-V5-EcoDam
(Plasmid #59204)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 59204 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pIND(V5)EcoDam
  • Backbone manufacturer
    van Steensal lab, Addgene plasmid 59201
  • Backbone size (bp) 7660
  • Modifications to backbone
    added Gatweway cassette
  • Vector type
    Mammalian Expression ; DamID
  • Promoter Heat Shock Minimal Promoter
  • Selectable markers
    Neomycin (select with G418)
  • Tags / Fusion Proteins
    • V5 (C terminal on backbone)
    • Dam (DNA adenine methyltransferase) (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    Unknown

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer pCasper-hs (GCAACTACTGAAATCTGCCAAG)
  • 3′ sequencing primer BGH-rev
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note that this vector can not be used to express Dam only.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pINDgw RFA-V5-EcoDam was a gift from Bas van Steensel (Addgene plasmid # 59204 ; http://n2t.net/addgene:59204 ; RRID:Addgene_59204)
  • For your References section:

    Human heterochromatin proteins form large domains containing KRAB-ZNF genes. Vogel MJ, Guelen L, de Wit E, Peric-Hupkes D, Loden M, Talhout W, Feenstra M, Abbas B, Classen AK, van Steensel B. Genome Res. 2006 Dec;16(12):1493-504. Epub 2006 Oct 12. 10.1101/gr.5391806 PubMed 17038565