pINDgw RFA-V5-EcoDam
(Plasmid
#59204)
-
Purpose(Empty Backbone) Mammalian DamID vector for fusing gene of interest with Dam-V5 using Gateway cloning
-
Depositing Lab
-
Depositing OrganizationNetherlands Cancer Institute
Located in Netherlands -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 59204 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepIND(V5)EcoDam
-
Backbone manufacturervan Steensal lab, Addgene plasmid 59201
- Backbone size (bp) 7660
-
Modifications to backboneadded Gatweway cassette
-
Vector typeMammalian Expression ; DamID
- Promoter Heat Shock Minimal Promoter
-
Selectable markersNeomycin (select with G418)
-
Tags
/ Fusion Proteins
- V5 (C terminal on backbone)
- Dam (DNA adenine methyltransferase) (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberUnknown
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer pCasper-hs (GCAACTACTGAAATCTGCCAAG)
- 3′ sequencing primer BGH-rev
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note that this vector can not be used to express Dam only.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pINDgw RFA-V5-EcoDam was a gift from Bas van Steensel (Addgene plasmid # 59204 ; http://n2t.net/addgene:59204 ; RRID:Addgene_59204) -
For your References section:
Human heterochromatin proteins form large domains containing KRAB-ZNF genes. Vogel MJ, Guelen L, de Wit E, Peric-Hupkes D, Loden M, Talhout W, Feenstra M, Abbas B, Classen AK, van Steensel B. Genome Res. 2006 Dec;16(12):1493-504. Epub 2006 Oct 12. 10.1101/gr.5391806 PubMed 17038565