Skip to main content

pRVdG-4Halo3-mCherry
(Plasmid #59327)

Ordering

This material is available to academics and nonprofits only. Orders shipped outside the U.S. may require additional regulatory approval, as well as a non-refundable export license fee of $85. Please log in to view availability.
Item Catalog # Description Quantity Price (USD)
Plasmid 59327 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    cSPBN (pSAD)
  • Backbone manufacturer
    Karl-Klaus Conzelmann & Matthias Schnell
  • Backbone size w/o insert (bp) 13782
  • Total vector size (bp) 15456
  • Vector type
    Mammalian Expression ; Rabies Virus

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    DH5alpha at 37C
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eNpHR 3.0-mCherry
  • Species
    Synthetic
  • Insert Size (bp)
    1674
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CATCAAAGTCAAGTTGATTACC
  • 3′ sequencing primer TAGACCTCTCCAGGATCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Alternative name: pRVdG-4Halo3C

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRVdG-4Halo3-mCherry was a gift from Ian Wickersham (Addgene plasmid # 59327 ; http://n2t.net/addgene:59327 ; RRID:Addgene_59327)