-
Purposeretroviral construct expressing the Tet repressor (TetR) tagged with mCherry
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59417 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepQCXIN
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 7400
- Total vector size (bp) 8738
-
Vector typeRetroviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTet repressor protein (TetR)
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer ACGCCATCCACGCTGTTTTGACCT
- 3′ sequencing primer AAGCGGCTTCGGCCAGTAACGTTA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe AgeI-EcoRI fragment from TetRmCherry (a gift from Dr E. Heard, see Masui et al Cell. 2011 Apr 29;145(3):447-58)was cloned to pQCIN vector by Christine Schmidt
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQCXIN-TetR-mCherry was a gift from Tom Misteli (Addgene plasmid # 59417 ; http://n2t.net/addgene:59417 ; RRID:Addgene_59417) -
For your References section:
Spatial dynamics of chromosome translocations in living cells. Roukos V, Voss TC, Schmidt CK, Lee S, Wangsa D, Misteli T. Science. 2013 Aug 9;341(6146):660-4. doi: 10.1126/science.1237150. 10.1126/science.1237150 PubMed 23929981