pQCXIP-GFP-LacR
(Plasmid #59418)

• Purpose: retroviral construct expressing the Lac repressor (LacR) tagged with GFP
• Depositing Lab: Tom Misteli
• Publication: Roukos et al Science. 2013 Aug 9;341(6146):660-4. doi: 10.1126/science.1237150.

Backbone

• Vector backbone: pQCXIP
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 7200
• Total vector size (bp): 9065
• Vector type: Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Lac repressor (LacR)
• Tag / Fusion Protein:
  • GFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (destroyed during cloning)
• 3′ cloning site: KpnI (destroyed during cloning)
• 5′ sequencing primer: ACGCCATCCACGCTGTTTTGACCT
• 3′ sequencing primer: AAGCGGCTTCGGCCAGTAACGTTA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The NheI-KpnI fragment derived from pEGFP-LacR (a gift from Dr M. Dundr, Rosalind Franklin University, Chicago, USA, see: Kaiser et al.,Science 322,1713–1717,2008) was blunted and cloned into the blunted EcoRI-NotI sites of the pQCXIP vector (Clontech) by Christine Schmidt

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry