-
Purposeretroviral construct expressing the Lac repressor (LacR) tagged with GFP
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59418 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepQCXIP
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 7200
- Total vector size (bp) 9065
-
Vector typeRetroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameLac repressor (LacR)
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (destroyed during cloning)
- 3′ cloning site KpnI (destroyed during cloning)
- 5′ sequencing primer ACGCCATCCACGCTGTTTTGACCT
- 3′ sequencing primer AAGCGGCTTCGGCCAGTAACGTTA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe NheI-KpnI fragment derived from pEGFP-LacR (a gift from Dr M. Dundr, Rosalind Franklin University, Chicago, USA, see: Kaiser et al.,Science 322,1713–1717,2008) was blunted and cloned into the blunted EcoRI-NotI sites of the pQCXIP vector (Clontech) by Christine Schmidt
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQCXIP-GFP-LacR was a gift from Tom Misteli (Addgene plasmid # 59418 ; http://n2t.net/addgene:59418 ; RRID:Addgene_59418) -
For your References section:
Spatial dynamics of chromosome translocations in living cells. Roukos V, Voss TC, Schmidt CK, Lee S, Wangsa D, Misteli T. Science. 2013 Aug 9;341(6146):660-4. doi: 10.1126/science.1237150. 10.1126/science.1237150 PubMed 23929981