Skip to main content
Addgene

pQCXIP-GFP-LacR
(Plasmid #59418)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59418 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pQCXIP
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 7200
  • Total vector size (bp) 9065
  • Vector type
    Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Lac repressor (LacR)
  • Tag / Fusion Protein
    • GFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (destroyed during cloning)
  • 3′ cloning site KpnI (destroyed during cloning)
  • 5′ sequencing primer ACGCCATCCACGCTGTTTTGACCT
  • 3′ sequencing primer AAGCGGCTTCGGCCAGTAACGTTA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The NheI-KpnI fragment derived from pEGFP-LacR (a gift from Dr M. Dundr, Rosalind Franklin University, Chicago, USA, see: Kaiser et al.,Science 322,1713–1717,2008) was blunted and cloned into the blunted EcoRI-NotI sites of the pQCXIP vector (Clontech) by Christine Schmidt
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQCXIP-GFP-LacR was a gift from Tom Misteli (Addgene plasmid # 59418 ; http://n2t.net/addgene:59418 ; RRID:Addgene_59418)
  • For your References section:

    Spatial dynamics of chromosome translocations in living cells. Roukos V, Voss TC, Schmidt CK, Lee S, Wangsa D, Misteli T. Science. 2013 Aug 9;341(6146):660-4. doi: 10.1126/science.1237150. 10.1126/science.1237150 PubMed 23929981