Skip to main content

Tol2-elavl3-H2B-GCaMP6s
(Plasmid #59530)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59530 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    MiniTol2
  • Vector type
    Transposable element

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    elavl3 promoter
  • Alt name
    HuC
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    8700
  • Entrez Gene
    elavl3 (a.k.a. HuC, elrc, id:ibd1248, wu:fb77b03, zHuC)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho1 (not destroyed)
  • 3′ cloning site Age1 (not destroyed)
  • 5′ sequencing primer TGATCTGCAAAAGACGTGAATATC
  • 3′ sequencing primer tttaacctctcagcgagaatgc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    H2B
  • Alt name
    Histone
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    378

Cloning Information for Gene/Insert 2

Gene/Insert 3

  • Gene/Insert name
    GCaMP6s
  • Species
    Synthetic
  • Insert Size (bp)
    1353

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACTCCAGCAGGACCATGTGAT
  • 3′ sequencing primer CATCGATGGTACAGTAAAACGACGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    GCaMP6s is from HHMI-Janelia Farm. There might be a patent. MiniTol2 backbone is from National Institute of Genetics Japan. Zebrafish elavl3 promoter is originally came from Brain Science Institute, RIKEN, Japan
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene NGS QC analysis identified multiple variants in the HuC promoter sequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Tol2-elavl3-H2B-GCaMP6s was a gift from Misha Ahrens (Addgene plasmid # 59530 ; http://n2t.net/addgene:59530 ; RRID:Addgene_59530)
  • For your References section:

    Mapping brain activity at scale with cluster computing. Freeman J, Vladimirov N, Kawashima T, Mu Y, Sofroniew NJ, Bennett DV, Rosen J, Yang CT, Looger LL, Ahrens MB. Nat Methods. 2014 Jul 27. doi: 10.1038/nmeth.3041. 10.1038/nmeth.3041 PubMed 25068736