-
PurposeExpressed nuclear-localized GCaMP6-slow, a calcium indicator, in neurons in zebrafish larva. The plasmid is in Tol2 transposon backbone
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 59530 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneMiniTol2
-
Vector typeTransposable element
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameelavl3 promoter
-
Alt nameHuC
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)8700
-
Entrez Geneelavl3 (a.k.a. HuC, elrc, id:ibd1248, wu:fb77b03, zHuC)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site Xho1 (not destroyed)
- 3′ cloning site Age1 (not destroyed)
- 5′ sequencing primer TGATCTGCAAAAGACGTGAATATC
- 3′ sequencing primer tttaacctctcagcgagaatgc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameH2B
-
Alt nameHistone
-
SpeciesH. sapiens (human)
-
Insert Size (bp)378
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer tttaacctctcagcgagaatgc
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameGCaMP6s
-
SpeciesSynthetic
-
Insert Size (bp)1353
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer ACTCCAGCAGGACCATGTGAT
- 3′ sequencing primer CATCGATGGTACAGTAAAACGACGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGCaMP6s is from HHMI-Janelia Farm. There might be a patent. MiniTol2 backbone is from National Institute of Genetics Japan. Zebrafish elavl3 promoter is originally came from Brain Science Institute, RIKEN, Japan
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene NGS QC analysis identified multiple variants in the HuC promoter sequence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Tol2-elavl3-H2B-GCaMP6s was a gift from Misha Ahrens (Addgene plasmid # 59530 ; http://n2t.net/addgene:59530 ; RRID:Addgene_59530) -
For your References section:
Mapping brain activity at scale with cluster computing. Freeman J, Vladimirov N, Kawashima T, Mu Y, Sofroniew NJ, Bennett DV, Rosen J, Yang CT, Looger LL, Ahrens MB. Nat Methods. 2014 Jul 27. doi: 10.1038/nmeth.3041. 10.1038/nmeth.3041 PubMed 25068736