Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #59530)


Item Catalog # Description Quantity Price (USD)
Plasmid 59530 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    elavl3 promoter
  • Alt name
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
  • Entrez Gene
    elavl3 (a.k.a. HuC, elrc, id:ibd1248, wu:fb77b03, zHuC)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho1 (not destroyed)
  • 3′ cloning site Age1 (not destroyed)
  • 5′ sequencing primer TGATCTGCAAAAGACGTGAATATC
  • 3′ sequencing primer tttaacctctcagcgagaatgc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)

Cloning Information for Gene/Insert 2

Gene/Insert 3

  • Gene/Insert name
  • Species
  • Insert Size (bp)

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACTCCAGCAGGACCATGTGAT
  • 3′ sequencing primer CATCGATGGTACAGTAAAACGACGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    GCaMP6s is from HHMI-Janelia Farm. There might be a patent. MiniTol2 backbone is from National Institute of Genetics Japan. Zebrafish elavl3 promoter is originally came from Brain Science Institute, RIKEN, Japan
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid

Depositor Comments

Addgene NGS QC analysis identified multiple variants in the HuC promoter sequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Tol2-elavl3-H2B-GCaMP6s was a gift from Misha Ahrens (Addgene plasmid # 59530 ; ; RRID:Addgene_59530)
  • For your References section:

    Mapping brain activity at scale with cluster computing. Freeman J, Vladimirov N, Kawashima T, Mu Y, Sofroniew NJ, Bennett DV, Rosen J, Yang CT, Looger LL, Ahrens MB. Nat Methods. 2014 Jul 27. doi: 10.1038/nmeth.3041. 10.1038/nmeth.3041 PubMed 25068736