tol2-GFAP::CD14
(Plasmid
#59593)
-
PurposeMagnetic cell sorting of ES cell-derived astrocytes
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 59593 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC18
-
Modifications to backboneHuman GFAP (gfa2) promoter, follwed by a 5' splice substrate, hCD14 ORF, a bGH poly-adenylation sequence and a FRT-neo-FRT resistance marker. This construct was flaked by tol2L/R recognition sequences.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman CD14
-
SpeciesH. sapiens (human)
-
Entrez GeneCD14
- Promoter gfa2
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GFAPpro-F ACTCCTTCATAAAGCCCTCG
- 3′ sequencing primer Neo-R (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
tol2-GFAP::CD14 was a gift from Ivo Lieberam (Addgene plasmid # 59593 ; http://n2t.net/addgene:59593 ; RRID:Addgene_59593) -
For your References section:
Optical control of muscle function by transplantation of stem cell-derived motor neurons in mice. Bryson JB, Machado CB, Crossley M, Stevenson D, Bros-Facer V, Burrone J, Greensmith L, Lieberam I. Science. 2014 Apr 4;344(6179):94-7. doi: 10.1126/science.1248523. 10.1126/science.1248523 PubMed 24700859
Map uploaded by the depositor.