Skip to main content
Addgene

tol2-GFAP::CD14
(Plasmid #59593)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59593 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC18
  • Modifications to backbone
    Human GFAP (gfa2) promoter, follwed by a 5' splice substrate, hCD14 ORF, a bGH poly-adenylation sequence and a FRT-neo-FRT resistance marker. This construct was flaked by tol2L/R recognition sequences.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human CD14
  • Species
    H. sapiens (human)
  • Entrez Gene
    CD14
  • Promoter gfa2

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GFAPpro-F ACTCCTTCATAAAGCCCTCG
  • 3′ sequencing primer Neo-R
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    tol2-GFAP::CD14 was a gift from Ivo Lieberam (Addgene plasmid # 59593 ; http://n2t.net/addgene:59593 ; RRID:Addgene_59593)
  • For your References section:

    Optical control of muscle function by transplantation of stem cell-derived motor neurons in mice. Bryson JB, Machado CB, Crossley M, Stevenson D, Bros-Facer V, Burrone J, Greensmith L, Lieberam I. Science. 2014 Apr 4;344(6179):94-7. doi: 10.1126/science.1248523. 10.1126/science.1248523 PubMed 24700859