Nanog-CreER targeting construct
(Plasmid
#59720)
-
PurposeCre-ER knockin targeting construct for mouse endogenous Nanog locus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 59720 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDT
- Total vector size (bp) 15024
-
Vector typeMouse Targeting
-
Selectable markersHygromycin ; DT
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecreERT2
-
SpeciesSynthetic
- Promoter mNanog
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TCTTTCTGTGGGAAGGCTGC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The backbone contains DT gene for negative selection.
Please visit https://www.biorxiv.org/content/early/2014/08/23/008284 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Nanog-CreER targeting construct was a gift from Jacob Hanna (Addgene plasmid # 59720 ; http://n2t.net/addgene:59720 ; RRID:Addgene_59720) -
For your References section:
Transient acquisition of pluripotency during somatic cell transdifferentiation with iPSC reprogramming factors. Maza I, Caspi I, Zviran A, Chomsky E, Rais Y, Viukov S, Geula S, Buenrostro JD, Weinberger L, Krupalnik V, Hanna S, Zerbib M, Dutton JR, Greenleaf WJ, Massarwa R, Novershtern N, Hanna JH. Nat Biotechnol. 2015 Jun 22. doi: 10.1038/nbt.3270. 10.1038/nbt.3270 PubMed 26098448