p221- purVSG117UTR
(Plasmid
#59732)
-
PurposeInserts a puromycin resistance gene and a VSG117 gene into the VSG221 expression site of T.brucei downstream of the expression site promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 59732 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBluescriptII
- Backbone size w/o insert (bp) 3045
- Total vector size (bp) 8476
-
Vector typeFor homologous recombination into VSG221 expression site in T. brucei
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVSG117 flanked upstream and downstream by sequences homologous to the VSG221 expression site
-
SpeciesT. brucei Lister 427
-
Insert Size (bp)5431
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer aacaaaagctggagctccac
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p221- purVSG117UTR was a gift from Gloria Rudenko (Addgene plasmid # 59732 ; http://n2t.net/addgene:59732 ; RRID:Addgene_59732) -
For your References section:
Blocking variant surface glycoprotein synthesis in Trypanosoma brucei triggers a general arrest in translation initiation. Smith TK, Vasileva N, Gluenz E, Terry S, Portman N, Kramer S, Carrington M, Michaeli S, Gull K, Rudenko G. PLoS One. 2009 Oct 26;4(10):e7532. doi: 10.1371/journal.pone.0007532. 10.1371/journal.pone.0007532 PubMed 19855834