pBSVSG221KOblast
(Plasmid #59733)

• Purpose: For replacement of VSG221 with a blasticidin resistence gene in the VSG221 expression site in T.brucei.
• Depositing Lab: Gloria Rudenko
• Publication: pBSVSG221KOblast (unpublished)

Backbone

• Vector backbone: pBluescriptII
• Backbone size w/o insert (bp): 2901
• Total vector size (bp): 4654
• Vector type: For homologous recombination into VSG221 expression site in T. brucei
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: BL21(DE3) is recommended by the depositing lab
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: VSG221 knockout construct
• Species: Trypanosoma brucei Lister 427
• Insert Size (bp): 1753

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: gctccaccgcggtggcggcc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry