Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pBSVSG221KOblast
(Plasmid #59733)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 59733 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBluescriptII
  • Backbone size w/o insert (bp) 2901
  • Total vector size (bp) 4654
  • Vector type
    For homologous recombination into VSG221 expression site in T. brucei
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    BL21(DE3) is recommended by the depositing lab
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    VSG221 knockout construct
  • Species
    Trypanosoma brucei Lister 427
  • Insert Size (bp)
    1753

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer gctccaccgcggtggcggcc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBSVSG221KOblast was a gift from Gloria Rudenko (Addgene plasmid # 59733 ; http://n2t.net/addgene:59733 ; RRID:Addgene_59733)