pCAG-T3-hCASeGFP-pA
(Plasmid
#59766)
-
PurposeExpresses CAS9-eGFP fusion protein in mammalian cells.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 59766 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAGGS
- Total vector size (bp) 10017
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCAS9
-
SpeciesSynthetic
-
Insert Size (bp)4188
- Promoter CAG
-
Tags
/ Fusion Proteins
- eGFP (C terminal on insert)
- Flag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CGTCCCCTTCTCCCTCTC
- 3′ sequencing primer ATTTTTGGCAGAGGGAAAAAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe human codon-optimized hCas9 insert in this vector was amplified from plasmid hCas9 (George Church; Addgene #41815).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The eGFP ORF was inserted into C-terminal of CAS9 ORF of
pCAG-T3-hCAS-pA (Addgene Plasmid #48625).
For the in vitro synthesis of CAS9 mRNAs, the vector was linearized by SphI and in-vitro transcribed using T3-RNA-polymerase (Promega) in the presence of m7G(5′)ppp(5′)G to synthesize capped RNA.
The Tbpl1 3′UTR 95 nucleotide polyA tail at the 3' end of the insert allows in vitro transcribed mRNA from this plasmid to be used directly for microinjection into animal embryos or oocytes without additional polyadenylation treatment.
The CAG promoter in this plasmid also allows it to be used as a CAS9eGFP-expression vector.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-T3-hCASeGFP-pA was a gift from Wataru Fujii (Addgene plasmid # 59766 ; http://n2t.net/addgene:59766 ; RRID:Addgene_59766) -
For your References section:
Efficient generation of large-scale genome-modified mice using gRNA and CAS9 endonuclease. Fujii W, Kawasaki K, Sugiura K, Naito K. Nucleic Acids Res. 2013 Aug 30. 10.1093/nar/gkt772 PubMed 23997119