Skip to main content

pMZ374
(Plasmid #59896)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59896 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMZ283
  • Backbone size w/o insert (bp) 6215
  • Total vector size (bp) 10640
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    ura4

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Cas9
  • Mutation
    Silent muation of the CspCI site
  • Promoter adh1

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTCAGCCCGAGTGACAGG
  • 3′ sequencing primer TGGAGAAAGGGAAGTCTAAAAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    rrk1:sgRNA
  • Promoter rrk1

Cloning Information for Gene/Insert 2

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that some batches of CspCI from New England Biolabs may cut inefficiently and alters the mobility of the DNA, possibly because it remains bound to the target. The two batches that are known to work are 0041303 and 0051407. This may be due to the particular target sequence present in pMZ283 and pMZ374.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMZ374 was a gift from Mikel Zaratiegui (Addgene plasmid # 59896 ; http://n2t.net/addgene:59896 ; RRID:Addgene_59896)
  • For your References section:

    Implementation of the CRISPR-Cas9 system in fission yeast. Jacobs JZ, Ciccaglione KM, Tournier V, Zaratiegui M. Nat Commun. 2014 Oct 29;5:5344. doi: 10.1038/ncomms6344. 10.1038/ncomms6344 PubMed 25352017