Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pScalps_puro_mIL-2Rβ
(Plasmid #59916)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 59916 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pScalps
  • Backbone size w/o insert (bp) 7740
  • Total vector size (bp) 9360
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    interleukin 2 receptor beta
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1620
  • Entrez Gene
    Il2rb (a.k.a. CD122, IL-15R, IL-15Rbeta, IL15R, IL15Rbeta, Il-2/15Rbeta, Il-2R, Il-2Rbeta, p70)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BAMHI (not destroyed)
  • 3′ cloning site NOTI (not destroyed)
  • 5′ sequencing primer GCTTCTCGCTTCTGTTCG
  • 3′ sequencing primer GTTGTCAAGCGATGAGGCGCGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pScalps_puro_mIL-2Rβ was a gift from Silvia Monticelli (Addgene plasmid # 59916 ; http://n2t.net/addgene:59916 ; RRID:Addgene_59916)
  • For your References section:

    Two Functionally Distinct Subsets of Mast Cells Discriminated By IL-2-Independent CD25 Activities. Deho' L, Leoni C, Brodie TM, Montagner S, De Simone M, Polletti S, Barozzi I, Natoli G, Monticelli S. J Immunol. 2014 Sep 1;193(5):2196-206. doi: 10.4049/jimmunol.1400516. Epub 2014 Jul 25. 10.4049/jimmunol.1400516 PubMed 25063866