Skip to main content

Eef1a-1955/-1>nls::Cas9::nls
(Plasmid #59987)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59987 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCESAx
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    nls::Cas9::nls
  • Alt name
    Cas9; SpCas9, humanized
  • Species
    Streptococcus pyogenes
  • Mutation
    Reverted mutations from dCas9 to wiltdtype
  • Promoter Ciinte.Eef1a (EF1alpha) -1955/-1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer gttagtactggttaggcgtttg
  • 3′ sequencing primer GGATTTCCTTACGCGAAATACG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Modified from Qi, L. S., Larson, M. H., Gilbert, L. a, Doudna, J. a, Weissman, J. S., Arkin, A. P. and Lim, W. a (2013). Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell 152, 1173–83.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Eef1a-1955/-1>nls::Cas9::nls was a gift from Lionel Christiaen (Addgene plasmid # 59987 ; http://n2t.net/addgene:59987 ; RRID:Addgene_59987)
  • For your References section:

    Tissue-specific genome editing in Ciona embryos by CRISPR/Cas9. Stolfi A, Gandhi S, Salek F, Christiaen L. Development. 2014 Nov;141(21):4115-20. doi: 10.1242/dev.114488. 10.1242/dev.114488 PubMed 25336740