Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Sox1/2/3-2373/+3>nls::Cas9::nls
(Plasmid #59989)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 59989 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    nls::Cas9::nls
  • Alt name
    Cas9; SpCas9, humanized
  • Species
    Streptococcus pyogenes
  • Mutation
    Reverted mutations from dCas9 to wiltdtype
  • Promoter Ciinte.Sox1/2/3 (SoxB1) -2373/+3

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GCGAACATTCGCCTAAAGTC
  • 3′ sequencing primer GGATTTCCTTACGCGAAATACG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Modified from Qi, L. S., Larson, M. H., Gilbert, L. a, Doudna, J. a, Weissman, J. S., Arkin, A. P. and Lim, W. a (2013). Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell 152, 1173–83.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Sox1/2/3-2373/+3>nls::Cas9::nls was a gift from Lionel Christiaen (Addgene plasmid # 59989 ; http://n2t.net/addgene:59989 ; RRID:Addgene_59989)
  • For your References section:

    Tissue-specific genome editing in Ciona embryos by CRISPR/Cas9. Stolfi A, Gandhi S, Salek F, Christiaen L. Development. 2014 Nov;141(21):4115-20. doi: 10.1242/dev.114488. 10.1242/dev.114488 PubMed 25336740