Sox1/2/3-2373/+3>nls::Cas9::nls
(Plasmid
#59989)
-
PurposeSox1/2/3 (SoxB1) driver driving nls::Cas9::nls
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59989 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCESAx
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namenls::Cas9::nls
-
Alt nameCas9; SpCas9, humanized
-
SpeciesStreptococcus pyogenes
-
MutationReverted mutations from dCas9 to wiltdtype
- Promoter Ciinte.Sox1/2/3 (SoxB1) -2373/+3
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GCGAACATTCGCCTAAAGTC
- 3′ sequencing primer GGATTTCCTTACGCGAAATACG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Modified from Qi, L. S., Larson, M. H., Gilbert, L. a, Doudna, J. a, Weissman, J. S., Arkin, A. P. and Lim, W. a (2013). Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell 152, 1173–83.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Sox1/2/3-2373/+3>nls::Cas9::nls was a gift from Lionel Christiaen (Addgene plasmid # 59989 ; http://n2t.net/addgene:59989 ; RRID:Addgene_59989) -
For your References section:
Tissue-specific genome editing in Ciona embryos by CRISPR/Cas9. Stolfi A, Gandhi S, Salek F, Christiaen L. Development. 2014 Nov;141(21):4115-20. doi: 10.1242/dev.114488. 10.1242/dev.114488 PubMed 25336740