Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLL7.0: Venus-iLID-Mito (From ActA)
(Plasmid #60413)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 60413 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Venus-iLID-Mito
  • Species
    Synthetic
  • Insert Size (bp)
    1338
  • Promoter CMV
  • Tag / Fusion Protein
    • Venus (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site SbfI (not destroyed)
  • 5′ sequencing primer none
  • 3′ sequencing primer CAGCAACCAGGATTTATACAAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLL7.0: Venus-iLID-Mito (From ActA) was a gift from Brian Kuhlman (Addgene plasmid # 60413 ; http://n2t.net/addgene:60413 ; RRID:Addgene_60413)
  • For your References section:

    Engineering an improved light-induced dimer (iLID) for controlling the localization and activity of signaling proteins. Guntas G, Hallett RA, Zimmerman SP, Williams T, Yumerefendi H, Bear JE, Kuhlman B. Proc Natl Acad Sci U S A. 2015 Jan 6;112(1):112-7. doi: 10.1073/pnas.1417910112. Epub 2014 Dec 22. 10.1073/pnas.1417910112 PubMed 25535392