-
PurposeMammalian Expression of Tiam DH/PH-tgRFPt-Micro
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 60418 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLentiLox7.0
-
Vector typeMammalian Expression, Lentiviral, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemTiam1-tgRFPt-SSPB R73Q
-
SpeciesM. musculus (mouse), Synthetic
-
Insert Size (bp)2289
-
MutationmTiam 64-437 // SSPB R73Q, Y11K and A15E
- Promoter CMV
-
Tag
/ Fusion Protein
- tgRFPt
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ApaI (not destroyed)
- 3′ cloning site PciI (not destroyed)
- 5′ sequencing primer none
- 3′ sequencing primer CAGCAACCAGGATTTATACAAGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The SspB used in this construct contains two amino acid mutations that disrupt the natural dimerization of SspB. These mutations are Y11K and A15E (residue numbering from pdb code 1ou9). Here is the sequence around the mutated residues with the sites of mutation in parentheses: SSPKRP(K)LLR(E)YYDWLVDNS
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLL7.0: mTiam1(64-437)-tgRFPt-SSPB R73Q was a gift from Brian Kuhlman (Addgene plasmid # 60418 ; http://n2t.net/addgene:60418 ; RRID:Addgene_60418) -
For your References section:
Engineering an improved light-induced dimer (iLID) for controlling the localization and activity of signaling proteins. Guntas G, Hallett RA, Zimmerman SP, Williams T, Yumerefendi H, Bear JE, Kuhlman B. Proc Natl Acad Sci U S A. 2015 Jan 6;112(1):112-7. doi: 10.1073/pnas.1417910112. Epub 2014 Dec 22. 10.1073/pnas.1417910112 PubMed 25535392