Skip to main content

AAV-FLEX-FLIM-AKART391A
(Plasmid #60446)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 60446 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    AAV-FLEX
  • Backbone manufacturer
    Scott Sternson
  • Backbone size w/o insert (bp) 5100
  • Total vector size (bp) 7000
  • Modifications to backbone
    N/A
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Use recombinase-free E. coli (e.g. Invitrogen's Stbl3)
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    FLIM-AKART391A
  • Species
    Synthetic
  • Insert Size (bp)
    1900
  • Mutation
    changed Threonine 391 to Ananine
  • Promoter CAG

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GCAACGTGCTGGTTATTGTG
  • 3′ sequencing primer GAGGTTGATTATCGATAAGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    AAV-FLEX-FLIM-AKART391A is a point mutant of AAV-FLEX-FLIM-AKAR from our laboratory. FLIM-AKAR was modified from AKAR3 from Jin Zhang's laboratory at Johns Hopkins University.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-FLEX-FLIM-AKART391A was a gift from Bernardo Sabatini (Addgene plasmid # 60446 ; http://n2t.net/addgene:60446 ; RRID:Addgene_60446)
  • For your References section:

    A PKA activity sensor for quantitative analysis of endogenous GPCR signaling via 2-photon FRET-FLIM imaging. Chen Y, Saulnier JL, Yellen G, Sabatini BL. Front Pharmacol. 2014 Apr 2;5:56. doi: 10.3389/fphar.2014.00056. eCollection 2014. 10.3389/fphar.2014.00056 PubMed 24765076