-
Purpose(Empty Backbone) SB-transposon with inducible SfiI cloning site for GOI (contains firefly luciferase) and constitutive expression of rtTA and puromycin resistance gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 60507 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
- Backbone size (bp) 2021
-
Vector typeMammalian Expression ; Transposon
- Promoter TCE & RPBSA
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer CCTGGAGCCAATTCCAACTCT
- 3′ sequencing primer CACTGCATTCTTGTTGTGGTT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSBtet-Pur was a gift from Eric Kowarz (Addgene plasmid # 60507 ; http://n2t.net/addgene:60507 ; RRID:Addgene_60507) -
For your References section:
Optimized Sleeping Beauty transposons rapidly generate stable transgenic cell lines. Kowarz E, Loescher D, Marschalek R. Biotechnol J. 2015 Feb 4. doi: 10.1002/biot.201400821. 10.1002/biot.201400821 PubMed 25650551