Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

mouse Oct4-GFP GOF18 transgenic reporter
(Plasmid #60527)


Item Catalog # Description Quantity Price (USD)
Plasmid 60527 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    pBS KS+
  • Backbone size w/o insert (bp) 3000
  • Total vector size (bp) 21615
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Promoter Oct4

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TTGTCCTGTCCAGACGTCCC
  • 3′ sequencing primer TACCTCTGAGCCTGGTCCGA
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

This construct is modified pGOF18 from Young Young Il Yeom et al.,Development 122, 000-000 (1996) 881.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mouse Oct4-GFP GOF18 transgenic reporter was a gift from Jacob Hanna (Addgene plasmid # 60527 ; ; RRID:Addgene_60527)
  • For your References section:

    Derivation of novel human ground state naive pluripotent stem cells. Gafni O, Weinberger L, Mansour AA, Manor YS, Chomsky E, Ben-Yosef D, Kalma Y, Viukov S, Maza I, Zviran A, Rais Y, Shipony Z, Mukamel Z, Krupalnik V, Zerbib M, Geula S, Caspi I, Schneir D, Shwartz T, Gilad S, Amann-Zalcenstein D, Benjamin S, Amit I, Tanay A, Massarwa R, Novershtern N, Hanna JH. Nature. 2013 Dec 12;504(7479):282-6. doi: 10.1038/nature12745. Epub 2013 Oct 30. 10.1038/nature12745 PubMed 24172903