Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

delta PE OCT4-GFP-2A-PURO transgenic reporter
(Plasmid #52380)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 52380 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    minimal Amp vector
  • Backbone size w/o insert (bp) 2278
  • Total vector size (bp) 21296
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    GFP-2A-puro
  • Species
    Synthetic

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    OCT4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    17400
  • Mutation
    deleted -1620 - -1011 upstream from OCT4 ATG
  • Entrez Gene
    POU5F1 (a.k.a. OCT3, OCT4, OTF-3, OTF3, OTF4, Oct-3, Oct-4, Oct3/4)

Cloning Information for Gene/Insert 2

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TTGTCTGTAAGCGGATGCCGG
  • 3′ sequencing primer CGCCTTTGAGTGAGCTGATACCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    delta PE OCT4-GFP-2A-PURO transgenic reporter was a gift from Jacob Hanna (Addgene plasmid # 52380 ; http://n2t.net/addgene:52380 ; RRID:Addgene_52380)
  • For your References section:

    Derivation of novel human ground state naive pluripotent stem cells. Gafni O, Weinberger L, Mansour AA, Manor YS, Chomsky E, Ben-Yosef D, Kalma Y, Viukov S, Maza I, Zviran A, Rais Y, Shipony Z, Mukamel Z, Krupalnik V, Zerbib M, Geula S, Caspi I, Schneir D, Shwartz T, Gilad S, Amann-Zalcenstein D, Benjamin S, Amit I, Tanay A, Massarwa R, Novershtern N, Hanna JH. Nature. 2013 Dec 12;504(7479):282-6. doi: 10.1038/nature12745. Epub 2013 Oct 30. 10.1038/nature12745 PubMed 24172903