Skip to main content

AAV-FLEX-VAMP2:HRP
(Plasmid #60659)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 60659 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    AAV-FLEX
  • Backbone size w/o insert (bp) 5020
  • Total vector size (bp) 1379
  • Vector type
    AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    VAMP2:HRP
  • Alt name
    Sbv2:HRP
  • Species
    B. taurus (bovine), Synthetic
  • Promoter CAG
  • Tag / Fusion Protein
    • Myc

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Spe1 (destroyed during cloning)
  • 3′ cloning site Spe1 (destroyed during cloning)
  • 5′ sequencing primer CTGTGGCTGCGTGAAAGCCTTG
  • 3′ sequencing primer CTGACAACGGGCCACAACTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Ege Kavalali provided the VAMP2 and the HRP cDNA

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-FLEX-VAMP2:HRP was a gift from Scott Sternson (Addgene plasmid # 60659 ; http://n2t.net/addgene:60659 ; RRID:Addgene_60659)
  • For your References section:

    A genetically specified connectomics approach applied to long-range feeding regulatory circuits. Atasoy D, Betley JN, Li WP, Su HH, Sertel SM, Scheffer LK, Simpson JH, Fetter RD, Sternson SM. Nat Neurosci. 2014 Dec;17(12):1830-9. doi: 10.1038/nn.3854. Epub 2014 Nov 2. 10.1038/nn.3854 PubMed 25362474