rAAV-CAG::FLEX-rev:: hM4D-2a-GFP
(Plasmid #52536)

• Purpose: Co-expresses hM4D and a green fluorescent label from a Cre-dependent virus
• Depositing Lab: Scott Sternson
• Publication: Atasoy et al Nature. 2012 Aug 9;488(7410):172-7. doi: 10.1038/nature11270.

Backbone

• Vector backbone: AAV2
• Backbone size w/o insert (bp): 5009
• Total vector size (bp): 7295
• Vector type: AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: Grow at 30 degrees in 2xYT media
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: hM4D-2a-GFP
• Alt name: muscarinic receptor 4, variant
• Alt name: GFP
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 2286
• Entrez Gene: CHRM4 (a.k.a. HM4, M4R)
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (destroyed during cloning)
• 3′ cloning site: SpeI (destroyed during cloning)
• 5′ sequencing primer: ctgtggctgcgtgaaagccttg
• 3′ sequencing primer: CATAAAGAGACAGCAACCAGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Bryan Roth, UNC
• Articles Citing this Plasmid:
  • 7 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

These vectors are prone to recombination. This is a well known issue with these AAV vectors and is due to the inverted terminal repeats (ITRs) required for AAV production. To minimize recombination, we propagate these plasmids in NEB Stable cells. Also, to minimize recombination, cells should be cultured at 30 C.

Note that these cultures will grow slowly (20 h for minipreps). Better yields and culture times are obtained with 2xYT as the media. This is strongly recommended.

Because recombination may still happen occasionally, we do a panel of restriction digestions to assess whether the ITRs are in tact. Separate digestions with PvuII, Sma1, and SnaB1 should be performed. The expected patterns can be calculated from the attached sequence.

Please note that this plasmid has a modified Chicken beta-actin promoter.