Skip to main content

pUCXKT
(Plasmid #60682)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 60682 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19
  • Vector type
    Bacterial Expression ; positive selection E. coli expression vector
  • Promoter tac

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    All temps fine, plasmid gains KanR when appropriate insert cloned, as per Prosser et al, Biotechnology Letters (2014)
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer GGCTCGTATAATGTGTGG
  • 3′ sequencing primer GACCGCTTCTGCGTTCTGAT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUCXKT was a gift from David Ackerley (Addgene plasmid # 60682 ; http://n2t.net/addgene:60682 ; RRID:Addgene_60682)
  • For your References section:

    A gain-of-function positive-selection expression plasmid that enables high-efficiency cloning. Prosser GA, Williams EM, Sissons JA, Walmsley KE, Parker MR, Ackerley DF. Biotechnol Lett. 2014 Sep 26. 10.1007/s10529-014-1673-4 PubMed 25257589
Commonly requested with: