-
PurposeExpresses T7 RNAP from the arabinose inducible promoter PBAD with a RBS strength of 500 from the Salis RBS calculator. Also includes a constitutive araC ORF
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60717 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBAD33
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 8000
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameT7 RNAP
-
Alt nameT7 RNA Polymerase
-
Insert Size (bp)2652
-
GenBank IDGI:216012
- Promoter PBAD
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (unknown if destroyed)
- 3′ cloning site SalI, HindIII, SphI (unknown if destroyed)
- 5′ sequencing primer acattgattatttgcacggcgtcacac (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPlasmid was modified from pTara, originally described by Dr. Kathleen Matthews at Rice University.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTara:500 was a gift from Matthew Bennett (Addgene plasmid # 60717 ; http://n2t.net/addgene:60717 ; RRID:Addgene_60717) -
For your References section:
Library of synthetic transcriptional AND gates built with split T7 RNA polymerase mutants. Shis DL, Bennett MR. Proc Natl Acad Sci U S A. 2013 Mar 26;110(13):5028-33. doi: 10.1073/pnas.1220157110. Epub 2013 Mar 11. 10.1073/pnas.1220157110 PubMed 23479654