Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
As of April 1, 2023, we increased some of our prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pTriEx-mCherry::LANS1
(Plasmid #60784)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 60784 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTriEx
  • Backbone size w/o insert (bp) 5943
  • Total vector size (bp) 6429
  • Vector type
    Mammalian Expression, Bacterial Expression, Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LANS1
  • Species
    Synthetic; Avena Sativa
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CCCAACACAATATATTATAGTTAAATAAGAATTATTATC
  • 3′ sequencing primer GGTGGTGCTCGAGATCCTCGGGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTriEx-mCherry::LANS1 was a gift from Brian Kuhlman (Addgene plasmid # 60784 ; http://n2t.net/addgene:60784 ; RRID:Addgene_60784)
  • For your References section:

    Control of Protein Activity and Cell Fate Specification via Light-Mediated Nuclear Translocation. Yumerefendi H, Dickinson DJ, Wang H, Zimmerman SP, Bear JE, Goldstein B, Hahn K, Kuhlman B. PLoS One. 2015 Jun 17;10(6):e0128443. doi: 10.1371/journal.pone.0128443. eCollection 2015. PONE-D-15-08811 [pii] PubMed 26083500