-
PurposeExpresses CaMPARI W391F V398L in mammalian cells, a photoconvertible fluorescent protein-based calcium integrator
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 60787 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerLife Technologies
- Backbone size w/o insert (bp) 5376
- Total vector size (bp) 6684
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCaMPARI W391F V398L
-
SpeciesSynthetic
-
Insert Size (bp)1308
- Promoter CMV
-
Tag
/ Fusion Protein
- Nuclear Export Signal (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGGTCTATATAAGCAGAGC
- 3′ sequencing primer AGATGGCTGGCAACTAGAAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr. Eric Schreiter created this plasmid.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3-CaMPARI W391F V398L was a gift from Loren Looger & Eric Schreiter (Addgene plasmid # 60787 ; http://n2t.net/addgene:60787 ; RRID:Addgene_60787) -
For your References section:
Neural circuits. Labeling of active neural circuits in vivo with designed calcium integrators. Fosque BF, Sun Y, Dana H, Yang CT, Ohyama T, Tadross MR, Patel R, Zlatic M, Kim DS, Ahrens MB, Jayaraman V, Looger LL, Schreiter ER. Science. 2015 Feb 13;347(6223):755-60. doi: 10.1126/science.1260922. 10.1126/science.1260922 PubMed 25678659