-
Purposeencodes zinc finger nuclease specific to AAVS1 locus (left)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60916 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePUC18
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAAVS1-ZFNL
-
Insert Size (bp)1018
- Promoter PGK
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GAGAAGAAGAGCGAGCTGC
- 3′ sequencing primer GACCTTCATAAAGAACTCCATC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PGK-AAVS1ZFNL was a gift from Paul Gadue (Addgene plasmid # 60916 ; http://n2t.net/addgene:60916 ; RRID:Addgene_60916) -
For your References section:
A Doxycycline-Inducible System for Genetic Correction of iPSC Disease Models. Sim X, Cardenas-Diaz FL, French DL, Gadue P. Methods Mol Biol. 2015 Jan 29. 10.1007/7651_2014_179 PubMed 25630922