Skip to main content

pPL5618_pUG_MtxR
(Plasmid #60929)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 60929 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUG27
  • Vector type
    LoxP flanked deletion cassette template

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Dihydrofolate reductase
  • Alt name
    DHFR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    561
  • Mutation
    L22F F31S
  • Entrez Gene
    DHFR (a.k.a. DHFR1, DHFRP1, DYR)
  • Promoter TEF1

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer cctcgctgcagacctgcgagcagg
  • 3′ sequencing primer gggcagatgatgtcgaggcg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    They were gene synthesized using a commercial service, which made them according to our design.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Dihydrofolate reductase gene from Homo sapiens carrying L22F and F31S mutations (DHFR*); codon optimized for expression in Saccharomyces cerevisiae. It also contains an additional F180L mutation that does not impact protein function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPL5618_pUG_MtxR was a gift from Robert Piper (Addgene plasmid # 60929 ; http://n2t.net/addgene:60929 ; RRID:Addgene_60929)
  • For your References section:

    Puromycin and Methotrexate Resistance Cassettes and Optimized cre-recombinase Expression Plasmids for use in Yeast. MacDonald C, Piper RC. Yeast. 2015 Feb 16. doi: 10.1002/yea.3069. 10.1002/yea.3069 PubMed 25688547