-
PurposeAuxin signalling reporter (DR5rev) driving RFP (ER-targeted)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61011 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHGWL7,0
- Total vector size (bp) 11908
-
Vector typePlant Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDR5rev::erRFP:35S_term
-
SpeciesSynthetic
-
Insert Size (bp)1500
- Promoter DR5rev::erRFP:35Sterm
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CACCTCGACGGTATCGCGCCCAGGG
- 3′ sequencing primer CGTAGCGAGACCACAGGAGCATGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
DR5rev::erRFP was a gift from Alexis Maizel (Addgene plasmid # 61011 ; http://n2t.net/addgene:61011 ; RRID:Addgene_61011) -
For your References section:
miR390, Arabidopsis TAS3 tasiRNAs, and their AUXIN RESPONSE FACTOR targets define an autoregulatory network quantitatively regulating lateral root growth. Marin E, Jouannet V, Herz A, Lokerse AS, Weijers D, Vaucheret H, Nussaume L, Crespi MD, Maizel A. Plant Cell. 2010 Apr;22(4):1104-17. doi: 10.1105/tpc.109.072553. Epub 2010 Apr 2. 10.1105/tpc.109.072553 PubMed 20363771