-
Purposelentiviral vector for GATA2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61063 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSIN4-EF1alpha-IRES-Puro
- Backbone size w/o insert (bp) 7500
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGATA2
-
SpeciesH. sapiens (human)
-
Entrez GeneGATA2 (a.k.a. DCML, IMD21, MONOMAC, NFE1B)
- Promoter EF1alpha
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer EF1a-Fwd
- 3′ sequencing primer pSIN-R: CAAACGCACACCGGCCTTATT
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSIN4-EF1a-GATA2-IRES-Puro was a gift from Igor Slukvin (Addgene plasmid # 61063 ; http://n2t.net/addgene:61063 ; RRID:Addgene_61063) -
For your References section:
Direct induction of haematoendothelial programs in human pluripotent stem cells by transcriptional regulators. Elcheva I, Brok-Volchanskaya V, Kumar A, Liu P, Lee JH, Tong L, Vodyanik M, Swanson S, Stewart R, Kyba M, Yakubov E, Cooke J, Thomson JA, Slukvin I. Nat Commun. 2014 Jul 14;5:4372. doi: 10.1038/ncomms5372. 10.1038/ncomms5372 PubMed 25019369