-
PurposeCRISPR/Cas9 plasmid containing sgRNA(F+E); for use in C. elegans
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61250 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDD162
-
Backbone manufacturerGoldstein lab
- Backbone size w/o insert (bp) 8113
- Total vector size (bp) 8148
-
Modifications to backboneOriginal sgRNA has been replaced with the improved synthetic guide RNA, sgRNA(F+E) (Chen et al., 2013, Cell). Contains an sgRNA sequence targeting the Y61A9LA.1 gene (Friedland et al., 2013, Nature Methods).
-
Vector typeWorm Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA(F+E)
-
SpeciesSynthetic
-
Insert Size (bp)123
- Promoter U6 promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer attgtgttcgttgagtgaccc
- 3′ sequencing primer ggtgtgaaataccgcacaga
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
target sequence: ggatggatgtgtagtcaatt
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJW1219 was a gift from Jordan Ward (Addgene plasmid # 61250 ; http://n2t.net/addgene:61250 ; RRID:Addgene_61250) -
For your References section:
Rapid and Precise Engineering of the Caenorhabditis elegans Genome with Lethal Mutation Co-conversion and Inactivation of NHEJ Repair. Ward JD. Genetics. 2014 Dec 9. pii: genetics.114.172361. 10.1534/genetics.114.172361 PubMed 25491644