Skip to main content

pJW1219
(Plasmid #61250)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61250 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDD162
  • Backbone manufacturer
    Goldstein lab
  • Backbone size w/o insert (bp) 8113
  • Total vector size (bp) 8148
  • Modifications to backbone
    Original sgRNA has been replaced with the improved synthetic guide RNA, sgRNA(F+E) (Chen et al., 2013, Cell). Contains an sgRNA sequence targeting the Y61A9LA.1 gene (Friedland et al., 2013, Nature Methods).
  • Vector type
    Worm Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA(F+E)
  • Species
    Synthetic
  • Insert Size (bp)
    123
  • Promoter U6 promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer attgtgttcgttgagtgaccc
  • 3′ sequencing primer ggtgtgaaataccgcacaga
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

target sequence: ggatggatgtgtagtcaatt

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJW1219 was a gift from Jordan Ward (Addgene plasmid # 61250 ; http://n2t.net/addgene:61250 ; RRID:Addgene_61250)
  • For your References section:

    Rapid and Precise Engineering of the Caenorhabditis elegans Genome with Lethal Mutation Co-conversion and Inactivation of NHEJ Repair. Ward JD. Genetics. 2014 Dec 9. pii: genetics.114.172361. 10.1534/genetics.114.172361 PubMed 25491644