Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pJW1219
(Plasmid #61250)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 61250 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDD162
  • Backbone manufacturer
    Goldstein lab
  • Backbone size w/o insert (bp) 8113
  • Total vector size (bp) 8148
  • Modifications to backbone
    Original sgRNA has been replaced with the improved synthetic guide RNA, sgRNA(F+E) (Chen et al., 2013, Cell). Contains an sgRNA sequence targeting the Y61A9LA.1 gene (Friedland et al., 2013, Nature Methods).
  • Vector type
    Worm Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA(F+E)
  • Species
    Synthetic
  • Insert Size (bp)
    123
  • Promoter U6 promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer attgtgttcgttgagtgaccc
  • 3′ sequencing primer ggtgtgaaataccgcacaga
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

target sequence: ggatggatgtgtagtcaatt

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJW1219 was a gift from Jordan Ward (Addgene plasmid # 61250 ; http://n2t.net/addgene:61250 ; RRID:Addgene_61250)
  • For your References section:

    Rapid and Precise Engineering of the Caenorhabditis elegans Genome with Lethal Mutation Co-conversion and Inactivation of NHEJ Repair. Ward JD. Genetics. 2014 Dec 9. pii: genetics.114.172361. 10.1534/genetics.114.172361 PubMed 25491644