-
PurposeCre-dependent Cas9 expression plasmid and targeting vector for the mouse Rosa26 locus. Cas9 expression is Cre-dependent and the targeting vector has positive (Neo) and negative (DTA) selection.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61408 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAi9
- Backbone size w/o insert (bp) 14500
- Total vector size (bp) 20541
-
Vector typeMammalian Expression, Mouse Targeting, Cre/Lox, CRISPR
-
Selectable markersNeomycin (select with G418) ; DTA
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsPlease note that this plasmid is prone to recombination. We recommend screening 3-5 colonies to ensure the full plasmid is intact.
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameCas9
-
SpeciesSynthetic; streptococcus pyogenes
-
Insert Size (bp)4101
-
Mutationhuman codon optimized
- Promoter CAG
-
Tags
/ Fusion Proteins
- 3xFLAG (N terminal on insert)
- P2A (C terminal on backbone)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer atgtctggatccccatcaagc
- 3′ sequencing primer CTGCTTGTCGGCCATGATATAG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameEGFP
-
Insert Size (bp)714
- Promoter CAG
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer TGTCTCAGCTGGGAGGCGAC
- 3′ sequencing primer gtatccacatagcgtaaaaggagc
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LSL-Cas9-Rosa26TV was a gift from Feng Zhang (Addgene plasmid # 61408 ; http://n2t.net/addgene:61408 ; RRID:Addgene_61408) -
For your References section:
CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Platt RJ, Chen S, Zhou Y, Yim MJ, Swiech L, Kempton HR, Dahlman JE, Parnas O, Eisenhaure TM, Jovanovic M, Graham DB, Jhunjhunwala S, Heidenreich M, Xavier RJ, Langer R, Anderson DG, Hacohen N, Regev A, Feng G, Sharp PA, Zhang F. Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014. 10.1016/j.cell.2014.09.014 PubMed 25263330