pBW313lux-hrpR
(Plasmid
#61436)
-
PurposepBWF2620 encoding rbs33-hrpR-ter (pBWF2620: pSB3K3 carrying BBa_F2620 (PTet-rbs34-luxR-ter))
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61436 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSB3K3
-
Backbone manufacturerBioBrick registry
- Backbone size w/o insert (bp) 2750
- Total vector size (bp) 4913
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameF2620-rbs33-hrpR-ter
-
SpeciesSynthetic
-
Insert Size (bp)2163
- Promoter plux
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer TGCCACCTGACGTCTAAGAA
- 3′ sequencing primer ATTACCGCCTTTGAGTGAGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThis plasmid was created by Dr Baojun Wang
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBW313lux-hrpR was a gift from Martin Buck & Baojun Wang (Addgene plasmid # 61436 ; http://n2t.net/addgene:61436 ; RRID:Addgene_61436) -
For your References section:
Engineering modular and orthogonal genetic logic gates for robust digital-like synthetic biology. Wang B, Kitney RI, Joly N, Buck M. Nat Commun. 2011 Oct 18;2:508. doi: 10.1038/ncomms1516. 10.1038/ncomms1516 PubMed 22009040