-
Purpose3rd generation lentiviral vector; constitutive expression of rtTA3 (TetON system)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61472 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFUGW
-
Backbone manufacturerLab of David Baltimore
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsuse Stbl3 if DH10B not available
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namertTA3
-
Alt namereverse tetracycline-controlled transactivator 3
- Promoter hEF1a
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TGGATCCCAAGGGCGAATTC
- 3′ sequencing primer TGCCGGAATTCACCACTTTG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV_hEF1a_rtTA3 was a gift from Ron Weiss (Addgene plasmid # 61472 ; http://n2t.net/addgene:61472 ; RRID:Addgene_61472) -
For your References section:
Rapid neurogenesis through transcriptional activation in human stem cells. Busskamp V, Lewis NE, Guye P, Ng AH, Shipman SL, Byrne SM, Sanjana NE, Murn J, Li Y, Li S, Stadler M, Weiss R, Church GM. Mol Syst Biol. 2014 Nov 17;10(11):760. doi: 10.15252/msb.20145508. PubMed 25403753