Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #61472)


Item Catalog # Description Quantity Price (USD)
Plasmid 61472 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    use Stbl3 if DH10B not available
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    reverse tetracycline-controlled transactivator 3
  • Promoter hEF1a

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TGGATCCCAAGGGCGAATTC
  • 3′ sequencing primer TGCCGGAATTCACCACTTTG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Article Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV_hEF1a_rtTA3 was a gift from Ron Weiss (Addgene plasmid # 61472 ; ; RRID:Addgene_61472)
  • For your References section:

    Rapid neurogenesis through transcriptional activation in human stem cells. Busskamp V, Lewis NE, Guye P, Ng AH, Shipman SL, Byrne SM, Sanjana NE, Murn J, Li Y, Li S, Stadler M, Weiss R, Church GM. Mol Syst Biol. 2014 Nov 17;10(11):760. doi: 10.15252/msb.20145508. PubMed 25403753