RAB14 Q70L
(Plasmid
#61494)
-
Purposeto overexpress constitutively active RAB14. Vector includes GFP driven by hUbC promoter
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61494 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepWCC43
-
Backbone manufacturera dual promoter lentivector made by the Civin lab
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRAB14
-
SpeciesH. sapiens (human)
-
Insert Size (bp)801
-
MutationQ70L, active form
-
GenBank ID
-
Entrez GeneRAB14 (a.k.a. FBP, RAB-14)
- Promoter EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer WCC43-F-seq TTCATTCTCAAGCCTCAGAC
- 3′ sequencing primer WCC43-R-seq CGGACGCTCGCTGCGCCCTTCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RAB14 Q70L was a gift from Curt Civin (Addgene plasmid # 61494 ; http://n2t.net/addgene:61494 ; RRID:Addgene_61494) -
For your References section:
MIR144 and MIR451 regulate human erythropoiesis via RAB14. Kim M, Tan YS, Cheng WC, Kingsbury TJ, Heimfeld S, Civin CI. Br J Haematol. 2014 Oct 14. doi: 10.1111/bjh.13164. 10.1111/bjh.13164 PubMed 25312678