Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

TetO-FUW-DN-REST
(Plasmid #61533)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 61533 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    TetO-FUW
  • Backbone size w/o insert (bp) 8376
  • Total vector size (bp) 11376
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    REST
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3000
  • Mutation
    P73, Dominant negative REST (contains the Zf DNA-binding region)
  • GenBank ID
    NM_005612
  • Entrez Gene
    REST (a.k.a. DFNA27, GINGF5, HGF5, NRSF, WT6, XBR)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer AAGACCACCGCACAGCAAGC
  • 3′ sequencing primer TTCCGCCGTGGCAATAGGGA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    DN-REST was obtained from Dr. Gail Mandel. Cell, Vol. 80, 949-957, March 24, 1995,

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TetO-FUW-DN-REST was a gift from Rudolf Jaenisch (Addgene plasmid # 61533 ; http://n2t.net/addgene:61533 ; RRID:Addgene_61533)
  • For your References section:

    Direct Lineage Conversion of Adult Mouse Liver Cells and B Lymphocytes to Neural Stem Cells. Cassady JP, D'Alessio AC, Sarkar S, Dani VS, Fan ZP, Ganz K, Roessler R, Sur M, Young RA, Jaenisch R. Stem Cell Reports. 2014 Nov 6. pii: S2213-6711(14)00307-5. doi: 10.1016/j.stemcr.2014.10.001. 10.1016/j.stemcr.2014.10.001 PubMed 25454632