Skip to main content

pcDNA-flag-mKdm4d(H189A)-polyA
(Plasmid #61554)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61554 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA
  • Backbone size w/o insert (bp) 5700
  • Total vector size (bp) 7238
  • Modifications to backbone
    flag and polyA sequences were added to 5' and 3' side of insert, respectively.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Kdm4d (catalytic mutant)
  • Alt name
    Jmjd2d (catalytic mutant)
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1527
  • Mutation
    changed Histidine 189 (of Kdm4d) to Alanine
  • Promoter CMV and T7
  • Tag / Fusion Protein
    • flag (N terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer cactgcttactggcttatcg
  • 3′ sequencing primer cgtttacaggttctttggtg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA-flag-mKdm4d(H189A)-polyA was a gift from Yi Zhang (Addgene plasmid # 61554 ; http://n2t.net/addgene:61554 ; RRID:Addgene_61554)
  • For your References section:

    Embryonic Development following Somatic Cell Nuclear Transfer Impeded by Persisting Histone Methylation. Matoba S, Liu Y, Lu F, Iwabuchi KA, Shen L, Inoue A, Zhang Y. Cell. 2014 Nov 6;159(4):884-95. doi: 10.1016/j.cell.2014.09.055. Epub 2014 Oct 30. 10.1016/j.cell.2014.09.055 PubMed 25417163