Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Pvalb-2A-Cre targeting vector
(Plasmid #61570)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 61570 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBS SK2+
  • Backbone size w/o insert (bp) 4496
  • Total vector size (bp) 16469
  • Modifications to backbone
    Contains a pPGK-DTA-bGHpA cassette, MCS region was modified
  • Vector type
    Mouse Targeting, Cre/Lox
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl2
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Pvalb exon 4 - 2A - Cre
  • Alt name
    Cre
  • Species
    M. musculus (mouse); P1 Bacteriophage
  • Insert Size (bp)
    11973

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Kpn (not destroyed)
  • 3′ cloning site Sac2 (not destroyed)
  • 5′ sequencing primer TCTTCGCTATTACGCCAGCT
  • 3′ sequencing primer AACAGCTATGACCATG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Pvalb-2A-Cre targeting vector was a gift from Hongkui Zeng (Addgene plasmid # 61570 ; http://n2t.net/addgene:61570 ; RRID:Addgene_61570)
  • For your References section:

    Transgenic mice for intersectional targeting of neural sensors and effectors with high specificity and performance. Madisen L, Garner AR, Shimaoka D, Chuong AS, Klapoetke NC, Li L, van der Bourg A, Niino Y, Egolf L, Monetti C, Gu H, Mills M, Cheng A, Tasic B, Nguyen TN, Sunkin SM, Benucci A, Nagy A, Miyawaki A, Helmchen F, Empson RM, Knopfel T, Boyden ES, Reid RC, Carandini M, Zeng H. Neuron. 2015 Mar 4;85(5):942-58. doi: 10.1016/j.neuron.2015.02.022. 10.1016/j.neuron.2015.02.022 PubMed 25741722