Pvalb-2A-Dre Flp-in replacement vector
(Plasmid
#61571)
-
PurposeRecombinase-mediated cassette exchange in ES cells to insert the Dre recombinase gene at the mouse Pvalb gene stop codon
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61571 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC57
- Backbone size w/o insert (bp) 2682
- Total vector size (bp) 5999
-
Modifications to backboneMCS region was modified
-
Vector typeRecombinase-mediated cassette exchange using Flp recombinase
-
Selectable markersPartial Hygro sequence
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePvalb-2A-Dre
-
Alt nameDre
-
SpeciesM. musculus (mouse); D6 Bacteriophage
-
Insert Size (bp)3317
-
Entrez GenePvalb (a.k.a. PV, Parv, Pva)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Kpn (not destroyed)
- 3′ cloning site Sac1 (not destroyed)
- 5′ sequencing primer TCTTCGCTATTACGCCAGCT
- 3′ sequencing primer AACAGCTATGACCATG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Pvalb-2A-Dre Flp-in replacement vector was a gift from Hongkui Zeng (Addgene plasmid # 61571 ; http://n2t.net/addgene:61571 ; RRID:Addgene_61571) -
For your References section:
Transgenic mice for intersectional targeting of neural sensors and effectors with high specificity and performance. Madisen L, Garner AR, Shimaoka D, Chuong AS, Klapoetke NC, Li L, van der Bourg A, Niino Y, Egolf L, Monetti C, Gu H, Mills M, Cheng A, Tasic B, Nguyen TN, Sunkin SM, Benucci A, Nagy A, Miyawaki A, Helmchen F, Empson RM, Knopfel T, Boyden ES, Reid RC, Carandini M, Zeng H. Neuron. 2015 Mar 4;85(5):942-58. doi: 10.1016/j.neuron.2015.02.022. 10.1016/j.neuron.2015.02.022 PubMed 25741722