-
PurposeStaphylococcus aureus (SaCas9) conjugated with mCherry
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84039 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepX601
-
Backbone manufacturerFeng Zhang's laboratory
- Backbone size w/o insert (bp) 7447
- Total vector size (bp) 8122
-
Modifications to backboneinserted mcherry downstream of SaCas9
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSaCas9
-
Alt nameSauCas9
-
gRNA/shRNA sequenceempty vector
-
SpeciesStaphylococcus aureus
- Promoter CMV
-
Tags
/ Fusion Proteins
- NLS (N terminal on insert)
- NLS (C terminal on insert)
- T2A-mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site EcoR I (not destroyed)
- 5′ sequencing primer Cas9-HidIII-S: gccccgtcgtgaagagaagcttcatcc
- 3′ sequencing primer mCherry –EcoR1-AS:cgtagaattcttacttgtacagctcgtccatgccgccggt (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX601-mCherry was a gift from Yuet Wai Kan (Addgene plasmid # 84039 ; http://n2t.net/addgene:84039 ; RRID:Addgene_84039) -
For your References section:
Genome editing using CRISPR-Cas9 to create the HPFH genotype in HSPCs: An approach for treating sickle cell disease and beta-thalassemia. Ye L, Wang J, Tan Y, Beyer AI, Xie F, Muench MO, Kan YW. Proc Natl Acad Sci U S A. 2016 Sep 20;113(38):10661-5. doi: 10.1073/pnas.1612075113. Epub 2016 Sep 6. 10.1073/pnas.1612075113 PubMed 27601644