pINTO-NSA::mEzh2
(Plasmid
#61725)
-
PurposeExpression of mouse Ezh2 fused to monomeric streptavidin (N-terminus)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61725 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepINTO-N-SA
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEnhancer of zeste homolog 2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2241
-
GenBank IDNM_007971.2
-
Entrez GeneEzh2 (a.k.a. Enx-1, Enx1h, KMT6, mKIAA4065)
-
Tag
/ Fusion Protein
- mSA (monomeric streptavidin) (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CTC GTT TAG TGA ACC GTC AG
- 3′ sequencing primer AGATGGCTGGCAACTAGAAG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pINTO-NSA::mEzh2 was a gift from Roberto Bonasio (Addgene plasmid # 61725 ; http://n2t.net/addgene:61725 ; RRID:Addgene_61725) -
For your References section:
In Vivo Proximity Labeling for the Detection of Protein-Protein and Protein-RNA Interactions. Beck DB, Narendra V, Drury WJ 3rd, Casey R, Jansen PW, Yuan ZF, Garcia BA, Vermeulen M, Bonasio R. J Proteome Res. 2014 Dec 5;13(12):6135-43. doi: 10.1021/pr500196b. Epub 2014 Oct 29. 10.1021/pr500196b PubMed 25311790