pCDNA-gp78-FLAG RING mutant C356G H361A
              
              
                (Plasmid
                
                #61751)
              
            
            
            
          - 
            Purposeexpress C-terminally FLAG tagged human gp78
- 
              Depositing Lab
- 
          Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61751 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepCDNA3
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 7332
- 
              Vector typeMammalian Expression
- 
                Selectable markersNeomycin (select with G418)
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)Top10
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert namegp78
- 
                  Alt nameAMFR, RNF45
- 
                    SpeciesH. sapiens (human)
- 
                  Insert Size (bp)1932
- 
                  MutationC356G H361A; P179L, F262L, Y315C, and D346G (please see depositor comment below)
- 
                    GenBank IDNM_001144.5
- 
                        Entrez GeneAMFR (a.k.a. GP78, RNF45, SPG89)
- Promoter CMV
- 
    
        Tag
        / Fusion Protein
    - FLAG (C terminal on insert)
 
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer ATTTAGGTGACACTATAG (Common Sequencing Primers)
Resource Information
- 
            A portion of this plasmid was derived from a plasmid made byWierds's Lab
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Mutations P179L, F262L, Y315C, and D346G found during Addgene's quality control process have no affect on plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pCDNA-gp78-FLAG RING mutant C356G H361A was a gift from Yihong Ye (Addgene plasmid # 61751 ; http://n2t.net/addgene:61751 ; RRID:Addgene_61751)
- 
                For your References section: USP13 antagonizes gp78 to maintain functionality of a chaperone in ER-associated degradation. Liu Y, Soetandyo N, Lee JG, Liu L, Xu Y, Clemons WM Jr, Ye Y. Elife. 2014;3:e01369. doi: 10.7554/eLife.01369. Epub 2014 Jan 14. 10.7554/eLife.01369 PubMed 24424410