Skip to main content
Addgene
Open Menu

pcDNA-flag-mZscan4d-polyA
(Plasmid #61831)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61831 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 61831-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 61831-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pcDNA
  • Backbone size w/o insert (bp) 5700
  • Total vector size (bp) 7226
  • Modifications to backbone
    flag and polyA sequences were added to 5' and 3' side of insert, respectively.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Zscan4d
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1515
  • Entrez Gene
    Zscan4d (a.k.a. EG545913)
  • Promoter CMV and T7
  • Tag / Fusion Protein
    • flag (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cactgcttactggcttatcg
  • 3′ sequencing primer cgtttacaggttctttggtg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA-flag-mZscan4d-polyA was a gift from Yi Zhang (Addgene plasmid # 61831 ; http://n2t.net/addgene:61831 ; RRID:Addgene_61831)

  • For your References section:

    Embryonic Development following Somatic Cell Nuclear Transfer Impeded by Persisting Histone Methylation. Matoba S, Liu Y, Lu F, Iwabuchi KA, Shen L, Inoue A, Zhang Y. Cell. 2014 Nov 6;159(4):884-95. doi: 10.1016/j.cell.2014.09.055. Epub 2014 Oct 30. 10.1016/j.cell.2014.09.055 PubMed 25417163
Related items:
Commonly requested with: