Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #61831)


Item Catalog # Description Quantity Price (USD)
Plasmid 61831 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5700
  • Total vector size (bp) 7226
  • Modifications to backbone
    flag and polyA sequences were added to 5' and 3' side of insert, respectively.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    XL10 Gold
  • Copy number


  • Gene/Insert name
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • Entrez Gene
    Zscan4d (a.k.a. EG545913)
  • Promoter CMV and T7
  • Tag / Fusion Protein
    • flag (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cactgcttactggcttatcg
  • 3′ sequencing primer cgtttacaggttctttggtg
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA-flag-mZscan4d-polyA was a gift from Yi Zhang (Addgene plasmid # 61831 ; ; RRID:Addgene_61831)
  • For your References section:

    Embryonic Development following Somatic Cell Nuclear Transfer Impeded by Persisting Histone Methylation. Matoba S, Liu Y, Lu F, Iwabuchi KA, Shen L, Inoue A, Zhang Y. Cell. 2014 Nov 6;159(4):884-95. doi: 10.1016/j.cell.2014.09.055. Epub 2014 Oct 30. 10.1016/j.cell.2014.09.055 PubMed 25417163